One of the most useful tools in biotechnology is that of restriction enzymes. Restriction enzymes scan double-stranded DNA for specific palindromic sequences and cut the DNA into two fragments at these positions. What is meant by a "palindromic sequence"? A palindrome is something that reads the same forward or backward. An example of a literary palindrome is "Madam I'm Adam "One of the longest palindromes in English is "A man, a plan, a canal , Panama." In DNA, a palindromic sequence occurs when its complementary DNA sequence is the same as the DNA sequence read back- ward. An example of a palindromic sequence in DNA is GAATTC,since the complementary sequence is CTTAAG. - In your notebook copy the following hypothetical sequence of DNA: ATGAATTCAGGCTA GGATATCCCA VAGCTCGAG AATATCCAAGATCTTGGGCCACC (a) Write out the sequence for the complementary strand. (b) Identify the palindromic sequences in the original fragment. (c) Using your knowledge of palindromes, write a 6 -base-pair sequence that is a palindrome.

Question

One of the most useful tools in biotechnology is that of restriction enzymes. Restriction enzymes scan double-stranded DNA for specific palindromic sequences and cut the DNA into two fragments at these positions. What is meant by a "palindromic sequence"? A palindrome is something that reads the same forward or backward. An example of a literary palindrome is "Madam I'm Adam "One of the longest palindromes in English is "A man, a plan, a canal , Panama." In DNA, a palindromic sequence occurs when its complementary DNA sequence is the same as the DNA sequence read back- ward. An example of a palindromic sequence in DNA is GAATTC,since the complementary sequence is CTTAAG. - In your notebook copy the following hypothetical sequence of DNA: ATGAATTCAGGCTA GGATATCCCA VAGCTCGAG AATATCCAAGATCTTGGGCCACC (a) Write out the sequence for the complementary strand. (b) Identify the palindromic sequences in the original fragment. (c) Using your knowledge of palindromes, write a 6 -base-pair sequence that is a palindrome.

Answer 1

**(a) Complementary Strand:**The complementary strand is formed by pairing A with T and G with C. So, the complementary strand to the given sequence:`ATGAATTCAGGCTAGGATATCCC AAGCTCC AGAATATCCA AGATCTTGGCCACC`is:`TACTTAAGTCCGATCCTATAGGG TTCGAGG TCTTATAGGT TCTAGAACCGGTGG`**(b) Identifying Palindromic Sequences:**A palindromic sequence in DNA reads the same 5' to 3' on one strand as it does 5' to 3' on the complementary strand. In the original fragment, we have:* **GAATTC:** Its complement is CTTAAG, which reads GAATTC backward.* **AGATCT:** Its complement is TCTAGA, which reads AGATCT backward.Therefore, the palindromic sequences are GAATTC and AGATCT.**(c) Creating a 6-Base-Pair Palindrome:**To create a 6-base-pair palindrome, we need a sequence where the first three bases are complementary to the last three bases in reverse order. Here's one example:**GGATCC** (Its complement is CCTAGG, which reads GGATCC backward).

Question

Solution

Answer