Home
/
Biology
/
One of the most useful tools in biotechnology is that of restriction enzymes. Restriction enzymes scan double-stranded DNA for specific palindromic sequences and cut the DNA into two fragments at these positions. What is meant by a "palindromic sequence"? A palindrome is something that reads the same forward or backward. An example of a literary palindrome is "Madam I'm Adam "One of the longest palindromes in English is "A man, a plan, a canal , Panama." In DNA, a palindromic sequence occurs when its complementary DNA sequence is the same as the DNA sequence read back- ward. An example of a palindromic sequence in DNA is GAATTC,since the complementary sequence is CTTAAG. - In your notebook copy the following hypothetical sequence of DNA: ATGAATTCAGGCTA GGATATCCCA VAGCTCGAG AATATCCAAGATCTTGGGCCACC (a) Write out the sequence for the complementary strand. (b) Identify the palindromic sequences in the original fragment. (c) Using your knowledge of palindromes, write a 6 -base-pair sequence that is a palindrome.

Question

One of the most useful tools in biotechnology is that of restriction enzymes. Restriction enzymes scan double-stranded DNA for specific palindromic sequences and cut the DNA into two fragments at these positions. What is meant by a "palindromic sequence"? A palindrome is something that reads the same forward or backward. An example of a literary palindrome is "Madam I'm Adam "One of the longest palindromes in English is "A man, a plan, a canal , Panama." In DNA, a palindromic sequence occurs when its complementary DNA sequence is the same as the DNA sequence read back- ward. An example of a palindromic sequence in DNA is GAATTC,since the complementary sequence is CTTAAG. - In your notebook copy the following hypothetical sequence of DNA: ATGAATTCAGGCTA GGATATCCCA VAGCTCGAG AATATCCAAGATCTTGGGCCACC (a) Write out the sequence for the complementary strand. (b) Identify the palindromic sequences in the original fragment. (c) Using your knowledge of palindromes, write a 6 -base-pair sequence that is a palindrome.

One of the most useful tools in biotechnology is that of restriction enzymes.
Restriction enzymes scan double-stranded DNA for specific palindromic
sequences and cut the DNA into two fragments at these positions. What is
meant by a "palindromic sequence"? A palindrome is something that reads
the same forward or backward. An example of a literary palindrome is
"Madam I'm Adam "One of the longest palindromes in English is "A man, a
plan, a canal , Panama." In DNA, a palindromic sequence occurs when its
complementary DNA sequence is the same as the DNA sequence read back-
ward. An example of a palindromic sequence in DNA is GAATTC,since the
complementary sequence is CTTAAG.
- In your notebook copy the following hypothetical sequence of DNA:
ATGAATTCAGGCTA GGATATCCCA VAGCTCGAG AATATCCAAGATCTTGGGCCACC
(a) Write out the sequence for the complementary strand.
(b) Identify the palindromic sequences in the original fragment.
(c) Using your knowledge of palindromes, write a 6 -base-pair sequence
that is a palindrome.

Solution

expert verifiedExpert Verified
4.1(229 Voting)
avatar
DouglasExpert · Tutor for 3 years

Answer

**(a) Complementary Strand:**<br /><br />The complementary strand is formed by pairing A with T and G with C. So, the complementary strand to the given sequence:<br /><br />`ATGAATTCAGGCTAGGATATCCC AAGCTCC AGAATATCCA AGATCTTGGCCACC`<br /><br />is:<br /><br />`TACTTAAGTCCGATCCTATAGGG TTCGAGG TCTTATAGGT TCTAGAACCGGTGG`<br /><br /><br />**(b) Identifying Palindromic Sequences:**<br /><br />A palindromic sequence in DNA reads the same 5' to 3' on one strand as it does 5' to 3' on the complementary strand. In the original fragment, we have:<br /><br />* **GAATTC:** Its complement is CTTAAG, which reads GAATTC backward.<br />* **AGATCT:** Its complement is TCTAGA, which reads AGATCT backward.<br /><br />Therefore, the palindromic sequences are GAATTC and AGATCT.<br /><br /><br />**(c) Creating a 6-Base-Pair Palindrome:**<br /><br />To create a 6-base-pair palindrome, we need a sequence where the first three bases are complementary to the last three bases in reverse order. Here's one example:<br /><br />**GGATCC** (Its complement is CCTAGG, which reads GGATCC backward).<br />
Click to rate: