- 1. Which of the following is true of a specimen that is not collected properly? (A) It may provide inaccurate test results. (B) It is not a problem as long as the right amount is collected. (C) It is not a problem as long as it is col- lected in the correct tube. (D) It is not a problem as long as the MA tells the lab that an error occurred.
- Host factors are the features regarding the host's susceptibility to parasites. square factors include the type of environment specific parasites grow best, the type of environment hosts have the most challenge in and climate of specific regions. square factors are the prevention methods done by producers to mitigate the effects of parasites square factors are specific char acteristics which impact the organism's ability to affect the host. 11 Parasite it Management : Weather
- What happens to a cell when there is a higher con centration of cell tha no de? a) Water moves into the cell by osmosis a. b. b) Water moves out of the cell by osmosis c. c) The cell becom es turgid d d) The cell bursts d. d)owyoen moving from leaf cells to air space in the leaf 8. What is the role of the central vacuole in plant cells? a) To store nutrients b. b) To store water c. c) To produce energy d. d) To transport oxygen m e or False 9. Diffusion requires energy input from the cell. __ 10. Osmo sis can cause a cell to burst If too much w water enters the cell. __ 11. Plant ro ots absorb wa ter from the soil by osmosis. __ 12. The co ncentra tion of solutes inside a cell does not affect osmosis. __ 13. Diffusion always occurs down a co ncentration gra dient. __ 14. Osmosis is not a type of diffusio n. __ 15. When water enters a cell faste than it lea res, the cell incr eases in size. __ 16. Osmosis stops when the con centration of water is equal on both sides of the r __ 17. Explain why osmosis is important for maintaining cell size and shape. 18. Explain the role of diffusion in cells.
- One of the most useful tools in biotechnology is that of restriction enzymes. Restriction enzymes scan double-stranded DNA for specific palindromic sequences and cut the DNA into two fragments at these positions. What is meant by a "palindromic sequence"? A palindrome is something that reads the same forward or backward. An example of a literary palindrome is "Madam I'm Adam "One of the longest palindromes in English is "A man, a plan, a canal , Panama." In DNA, a palindromic sequence occurs when its complementary DNA sequence is the same as the DNA sequence read back- ward. An example of a palindromic sequence in DNA is GAATTC,since the complementary sequence is CTTAAG. - In your notebook copy the following hypothetical sequence of DNA: ATGAATTCAGGCTA GGATATCCCA VAGCTCGAG AATATCCAAGATCTTGGGCCACC (a) Write out the sequence for the complementary strand. (b) Identify the palindromic sequences in the original fragment. (c) Using your knowledge of palindromes, write a 6 -base-pair sequence that is a palindrome.
- An example of milosis at work is a leaf tuming yellow growing taking in carbon dioxide performing photosynthesis
